IthaID: 2103
Names and Sequences
Functionality: | Disease modifying mutation | Pathogenicity: | N/A |
---|---|---|---|
Common Name: | rs6904897 | HGVS Name: | NC_000006.12:g.135061842T>G |
Context nucleotide sequence:
CAGGCTTGCCAAATATACCTTGTTA [G/T] TGTATGCACAACcaaaagaaataca (Strand: +)
Also known as:
Comments: SNP associated with variation in F-cell numbers in healthy Northern Europeans (TwinUK cohort). It exhibited strong effect on the severity of β-thalassaemia phenotype in Sardinian subjects.
We follow the HGVS sequence variant nomenclature and IUPAC standards.
External Links
Phenotype
Allele Phenotype (Cis): | N/A |
---|---|
Allele Phenotype (Trans): | N/A |
Associated Phenotypes: | F-cell numbers |
Location
Chromosome: | 6 |
---|---|
Locus: | NT_025741.15 |
Locus Location: | N/A |
Size: | 1 bp |
Located at: | HBS1L-MYB |
Specific Location: | N/A |
Other details
Type of Mutation: | Point-Mutation(Substitution) |
---|---|
Effect on Gene/Protein Function: | N/A |
Ethnic Origin: | Sardinian, Northern European |
Molecular mechanism: | N/A |
Inheritance: | Quantitative trait |
DNA Sequence Determined: | Yes |
In silico pathogenicity prediction
Note:
The impact thresholds provided in this section are based on the analyses performed in Tamana et.al. For any given tool, the impact thresholds defined for the set of variants with the same effect on function as the variant examined, are preferred over those defined for the full dataset.
Sequence Viewer
Note: The NCBI Sequence Viewer is not installed on the ITHANET servers but it is embedded in this page from the NCBI.
Therefore, IthaGenes has no responsibility over any temporary unavailability of the service.
In such a case, please Refresh the page or retry at a later stage.
Otherwise, use this external link.
Publications / Origin
- Menzel S, Garner C, Gut I, Matsuda F, Yamaguchi M, Heath S, Foglio M, Zelenika D, Boland A, Rooks H, Best S, Spector TD, Farrall M, Lathrop M, Thein SL, A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15., Nat. Genet. , 39(10), 1197-9, 2007 PubMed
- Danjou F, Anni F, Perseu L, Satta S, Dessì C, Lai ME, Fortina P, Devoto M, Galanello R, Genetic modifiers of β-thalassemia and clinical severity as assessed by age at first transfusion., Haematologica , 97(7), 989-93, 2012 PubMed
Created on 2013-09-13 14:34:30,
Last reviewed on 2018-11-20 17:42:33 (Show full history)
A/A | Date | Curator(s) | Comments |
---|---|---|---|
1 | 2013-09-13 14:34:30 | The IthaGenes Curation Team | Created |
2 | 2013-10-15 17:00:14 | The IthaGenes Curation Team | Reviewed. |
3 | 2015-11-13 16:51:27 | The IthaGenes Curation Team | Reviewed. |
4 | 2016-05-18 11:01:28 | The IthaGenes Curation Team | Reviewed. |
5 | 2018-11-20 17:42:33 | The IthaGenes Curation Team | Reviewed. Locus added. |
Disclaimer: The information on this website is provided as an information resource only
and must not to be used as a substitute for professional diagnosis and treatment.
The ITHANET Portal and IthaGenes are not responsible or liable for any advice, course of treatment,
diagnosis or any other information, services or products that an individual obtains through this website.
IthaGenes was last updated on 2024-04-30 12:06:09